View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14046_low_7 (Length: 452)

Name: NF14046_low_7
Description: NF14046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14046_low_7
NF14046_low_7
[»] chr7 (2 HSPs)
chr7 (351-431)||(2601217-2601297)
chr7 (351-426)||(2614680-2614748)


Alignment Details
Target: chr7 (Bit Score: 81; Significance: 6e-38; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 351 - 431
Target Start/End: Original strand, 2601217 - 2601297
Alignment:
351 ttaattaacatctattggctttgctttggtgtcatgtcatgtttctagcatattgactctagtaagataaaatgaataatc 431  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2601217 ttaattaacatctattggctttgctttggtgtcatgtcatgtttctagcatattgactctagtaagataaaatgaataatc 2601297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 426
Target Start/End: Original strand, 2614680 - 2614748
Alignment:
351 ttaattaacatctattggctttgctttggtgtcatgtcatgtttctagcatattgactctagtaagataaaatgaa 426  Q
    ||||||||||||||| |||||||||||||     ||||||||||||| ||||||||  ||||||||||||||||||    
2614680 ttaattaacatctatcggctttgctttgg-----tgtcatgtttctaccatattga--ctagtaagataaaatgaa 2614748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University