View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14048_low_8 (Length: 224)
Name: NF14048_low_8
Description: NF14048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14048_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 208
Target Start/End: Complemental strand, 39576211 - 39576017
Alignment:
| Q |
14 |
catcacttgggtcaattctattgacctttctcattgccatgggtggtatggccctctcgaaaggtactacacttcatagattgaagtagtcaaagttaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39576211 |
catcacttgggtcaattctattgacctttctcattgccatgggtggcatggccctctcgaaaggtactacacttcatagattgaagtagtcaaagttaat |
39576112 |
T |
 |
| Q |
114 |
gtttctcctatatattattgttagaatttagagtaaaaataccttcccacnnnnnnnnnnnnnggtttcagataatattacaaaagggtggatat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39576111 |
gtttctcctatatattattgttagaatttagagtaacaataccttcccacttttttgctttttggtttcagataatattacaaaagggtggatat |
39576017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University