View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14049_low_1 (Length: 285)
Name: NF14049_low_1
Description: NF14049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14049_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 17 - 91
Target Start/End: Original strand, 34518506 - 34518582
Alignment:
| Q |
17 |
tttttctcgtcttatccattctaatcacttatcatctgtat--tatcattcttgtgtcttgatatatttttagtgct |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
34518506 |
tttttctcgtcttatccattctaatcacttttcatctgtattatatcattcttgtgtcttgatatacttttagtgct |
34518582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 226 - 270
Target Start/End: Original strand, 34518697 - 34518741
Alignment:
| Q |
226 |
agaatggaataagttaaaattgtgcaagaatcttacttacatttt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34518697 |
agaatggaataagttaaaattgtgcaagaatcttacttacatttt |
34518741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 148
Target Start/End: Original strand, 34518573 - 34518610
Alignment:
| Q |
111 |
ttttagtgctgttatatatacatgaatgagtatcttga |
148 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34518573 |
ttttagtgctattatatatacatgaatgagtatcttga |
34518610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University