View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_109 (Length: 273)
Name: NF1404_high_109
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_109 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 52 - 197
Target Start/End: Complemental strand, 9562097 - 9561952
Alignment:
| Q |
52 |
ggaagaaccttcttattataagctcctatacccgatcaattggttcggtgcggtcttgcaaagctattccttctgagacatcggcaagtgatttgagatt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9562097 |
ggaagaaccttcttattataagctcctatacccgatcaattggttcggtgcggtcttgcaaagctattccttctgagacatcggcaagtgatttgagatt |
9561998 |
T |
 |
| Q |
152 |
gcacttaataaccgcttcaacgaagtagcaggtctcgtctgtggtg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9561997 |
gcacttaataaccgcttcaacgaagtagcaggtctcgtctttggtg |
9561952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 83 - 187
Target Start/End: Original strand, 41327871 - 41327975
Alignment:
| Q |
83 |
ccgatcaattggttcggtgcggtcttgcaaagctattccttctgagacatcggcaagtgatttgagattgcacttaataaccgcttcaacgaagtagcag |
182 |
Q |
| |
|
|||||||| |||||| ||| |||| |||| ||| ||||||||||||||| | |||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
41327871 |
ccgatcaagtggttcagtgaggtcctgcacagcatgtccttctgagacatctgaaagtgatttgagattgcacttaattaaggcttcaacgaagtagcag |
41327970 |
T |
 |
| Q |
183 |
gtctc |
187 |
Q |
| |
|
||||| |
|
|
| T |
41327971 |
gtctc |
41327975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University