View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_116 (Length: 252)
Name: NF1404_high_116
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_116 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 59 - 179
Target Start/End: Complemental strand, 4195110 - 4194990
Alignment:
| Q |
59 |
agagtgtgagaatgtgtgtggtgctttgagttgtttttgtagggagggaagtaagtaggaagtaatgattttgtgacacattaggtggggacaggtcaat |
158 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195110 |
agagtgtgagaatgtgtgtgatgctttgagttgtttttgtagggagggaagtaagtaggaagtaatgattttgtgacacattaggtggggacaggtcaat |
4195011 |
T |
|
| Q |
159 |
caggtaaactaggccctacta |
179 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4195010 |
caggtaaactaggccctacta |
4194990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 4195154 - 4195125
Alignment:
| Q |
1 |
caacggttcagtttgtgttaccattgtgta |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4195154 |
caacggttcagtttgtgttaccattgtgta |
4195125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University