View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_129 (Length: 224)
Name: NF1404_high_129
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_129 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 36154050 - 36153928
Alignment:
| Q |
1 |
ggttggcttttatagtttagggggatggaaattattgattggttaattaggtgcaatgttttgtcagaaaggtgcagtttctgatagaacaaatcttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36154050 |
ggttggcttttatagtttagggggatggaaattattgattggttaattaggtgcaatgttttgtcagaaaggtgcagtttctgatagaacaaatcttctt |
36153951 |
T |
 |
| Q |
101 |
tgtctgtcatggaaaggtggtgt |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36153950 |
tgtctgtcatggaaaggtggtgt |
36153928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 36150660 - 36150588
Alignment:
| Q |
1 |
ggttggcttttatagtttagggggatggaaattattgattggttaattaggtgcaatgttttgtcagaaaggt |
73 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36150660 |
ggttggcttttatagtttagggagatggaaattaatgattggttaattaggtgcaatgttttatcagaaaggt |
36150588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University