View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1404_high_129 (Length: 224)

Name: NF1404_high_129
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1404_high_129
NF1404_high_129
[»] chr8 (2 HSPs)
chr8 (1-123)||(36153928-36154050)
chr8 (1-73)||(36150588-36150660)


Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 36154050 - 36153928
Alignment:
1 ggttggcttttatagtttagggggatggaaattattgattggttaattaggtgcaatgttttgtcagaaaggtgcagtttctgatagaacaaatcttctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36154050 ggttggcttttatagtttagggggatggaaattattgattggttaattaggtgcaatgttttgtcagaaaggtgcagtttctgatagaacaaatcttctt 36153951  T
101 tgtctgtcatggaaaggtggtgt 123  Q
    |||||||||||||||||||||||    
36153950 tgtctgtcatggaaaggtggtgt 36153928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 36150660 - 36150588
Alignment:
1 ggttggcttttatagtttagggggatggaaattattgattggttaattaggtgcaatgttttgtcagaaaggt 73  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||||    
36150660 ggttggcttttatagtttagggagatggaaattaatgattggttaattaggtgcaatgttttatcagaaaggt 36150588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University