View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_133 (Length: 214)
Name: NF1404_high_133
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_133 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 3 - 117
Target Start/End: Complemental strand, 19506597 - 19506483
Alignment:
| Q |
3 |
gtaactttaccaactttgatggcttttccttccttgtcaaaacatggttttgccgtaaaatatctgaagctgtagtctctgagactctcatatctcactg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19506597 |
gtaactttaccaactttgatggcttttccttccttgtcaaaacatggttttgccgtaaaatatctgaagcagtagtctctgagactctcatatctcactg |
19506498 |
T |
 |
| Q |
103 |
gattcccaacagatg |
117 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19506497 |
gattcccaacagatg |
19506483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University