View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_142 (Length: 206)
Name: NF1404_high_142
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_142 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 2 - 139
Target Start/End: Original strand, 29337010 - 29337148
Alignment:
| Q |
2 |
tcagaagtttagaacaggttgaaaataaagagtgttacataccctctcttaagtt-caagttcaaactgatggttgcttgcttctgagatcaactataaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29337010 |
tcagaagtttagaacaggttgaaaataaagagtgttacataccctctcttaagtttcaagttcaaactgatggttgcttgcttctgagatcaactataaa |
29337109 |
T |
|
| Q |
101 |
ctgctttggaaattggagacatgtttttcctttgcttct |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
29337110 |
ctgctttggaaattggagacatgtttttccattgtttct |
29337148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University