View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1404_high_143 (Length: 206)

Name: NF1404_high_143
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1404_high_143
NF1404_high_143
[»] chr3 (1 HSPs)
chr3 (2-139)||(29337010-29337148)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 2 - 139
Target Start/End: Original strand, 29337010 - 29337148
Alignment:
2 tcagaagtttagaacaggttgaaaataaagagtgttacataccctctcttaagtt-caagttcaaactgatggttgcttgcttctgagatcaactataaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
29337010 tcagaagtttagaacaggttgaaaataaagagtgttacataccctctcttaagtttcaagttcaaactgatggttgcttgcttctgagatcaactataaa 29337109  T
101 ctgctttggaaattggagacatgtttttcctttgtttct 139  Q
    |||||||||||||||||||||||||||||| ||||||||    
29337110 ctgctttggaaattggagacatgtttttccattgtttct 29337148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University