View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_146 (Length: 203)
Name: NF1404_high_146
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_146 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 6890320 - 6890492
Alignment:
| Q |
1 |
gtgttttttgtgtttggttttgaaaaagagtcaatgaggggacacacacactaacttgcccttcttttctgcannnnnnnncttagtgaagaggggagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
6890320 |
gtgttttttgtgtttggttttgaaaaagagtcaatgaggggacacacacactaacttgcccttcttttctgcattttttt-cttagtgaagaggagagga |
6890418 |
T |
|
| Q |
101 |
aagataagcaaaagcagccatgtatttgaaaaatagtgatgtggggcccactaatgtcttacatataataacat |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6890419 |
aagataagcaaaagcagccatgtatttgaaaaatagtgatgtggggcccactaatgtcttacatataataacat |
6890492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University