View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_53 (Length: 391)
Name: NF1404_high_53
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 279 - 385
Target Start/End: Complemental strand, 26371350 - 26371244
Alignment:
| Q |
279 |
attaatagtatttttaaaaaataattctcaccataaagtatatgctattttgactacatttaaattgaaaaatataaattttgactaattttctttagta |
378 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26371350 |
attaatcgtatttttaaaaattaattctcaccataaagtatatgctattttgactacatttaaactgaaaaatataaattttgactaattttctttagta |
26371251 |
T |
|
| Q |
379 |
ttatcta |
385 |
Q |
| |
|
||||||| |
|
|
| T |
26371250 |
ttatcta |
26371244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 151 - 214
Target Start/End: Complemental strand, 26371478 - 26371415
Alignment:
| Q |
151 |
gcttagaataacaaaactttattgaatagagaaagaaaatctaaaattatgaaattctagagag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26371478 |
gcttagaataacaaaactttattgaatagagaaagaaaatctaaaattatgaaattctagagag |
26371415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 26371599 - 26371549
Alignment:
| Q |
30 |
gcttagtctatataaattgtaatcaatgtctgaaacacatgatgactgttc |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26371599 |
gcttagtctatataaattgtaatcaatgtctgaaacacatgatgactgttc |
26371549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University