View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_60 (Length: 381)
Name: NF1404_high_60
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_60 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 46 - 367
Target Start/End: Complemental strand, 7543741 - 7543420
Alignment:
| Q |
46 |
tttatacctgaagaaatcgacgaaggggtctaggagcacctttagcaataggttgttgttgattagaagaatgacgccacgaaaccttaccattgctacc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7543741 |
tttatacctgaagaaatcgacgaaggggtctaggagcacctttagcaataggttgttgttgattagaagaatgacgccacgaaaccttaccattgctacc |
7543642 |
T |
|
| Q |
146 |
acaactaaccttgcaaccagacacaatgagttctaaacaccacaaatctggatccttttgccataaaacaaatcctccactctcttcagaggnnnnnnnc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7543641 |
acaactaaccttgcaaccagacacaatgagttctaaacaccacaaatctggatccttttgccataaaacaaatcctccactctcttcagaggtttttttc |
7543542 |
T |
|
| Q |
246 |
acttcaatggtttcaccagtatgatgaaaatctgaagcagtaatcctgacttgccccattacacacatactttcaaccacattcaatgctggttgtcctc |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7543541 |
acttcaatggtttcaccagtatgatgaaaatctgaagcagtaatcctgacttgccccattacacacatactttcaaccacattcaatgctggttgtcctc |
7543442 |
T |
|
| Q |
346 |
ctgttgctgctatatattgttg |
367 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7543441 |
ctgttgctgctatatattgttg |
7543420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University