View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_87 (Length: 322)
Name: NF1404_high_87
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_87 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 241
Target Start/End: Original strand, 30416949 - 30417181
Alignment:
| Q |
9 |
accacagaagccagaatcagaacaaagaacagaatcatacacacatatgcagcactcagaaaacaaagacccagtttcttaagcaatactatgctaccat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30416949 |
accacagaagccagaatcagaacaaagaacagaatcatacacacatatgcagcactcagaaaacaaagacccagtttcttaagcaatactatgctaccat |
30417048 |
T |
|
| Q |
109 |
aagctatttgtgaaggagcattgtctttggtttgcccatcatgatggtaggactcagatgtcactgtcagaagagagtagaaaggggaaaagacagaggc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30417049 |
aagctatttgtgaaggagcattgtctttggtttgcccatcatgatggtaggactcagatgtcactgtcagaagtgagtagaaaggggaaaagacagaggc |
30417148 |
T |
|
| Q |
209 |
catgctgttgtagagtaagtctgctggtgtagg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30417149 |
catgctgttgtagagtaagtctgctggtgtagg |
30417181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University