View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_88 (Length: 321)
Name: NF1404_high_88
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 78 - 242
Target Start/End: Complemental strand, 38215414 - 38215250
Alignment:
| Q |
78 |
aataatgtgtcgctcagtcaatcacttggttcacaagtcattcaattttatgaaatactaataaacatttttgtcacagatcaacatgtggtttgtatgt |
177 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38215414 |
aataatgtgtcactcagtcaatcacttggttcacaagtcattcaattttatgaaatactaataaacatttttgtcacagatcaacatgtggtttgtatgt |
38215315 |
T |
 |
| Q |
178 |
ggacattttatattttcactagcaatacttgtgctgttgtttagcaccccatcatgctcaacttc |
242 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||| ||||||| ||||||||| |
|
|
| T |
38215314 |
ggacattttgtattttcactagcaatacttgtgctgttctttagcacaccatcattctcaacttc |
38215250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 154 - 224
Target Start/End: Complemental strand, 38221377 - 38221307
Alignment:
| Q |
154 |
cagatcaacatgtggtttgtatgtggacattttatattttcactagcaatacttgtgctgttgtttagcac |
224 |
Q |
| |
|
|||||||||||||||| |||| | || ||||| | |||||| | ||||||||||||||||||||| |||| |
|
|
| T |
38221377 |
cagatcaacatgtggtgtgtacctagagattttgttttttcattggcaatacttgtgctgttgtttggcac |
38221307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University