View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_89 (Length: 319)
Name: NF1404_high_89
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_89 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 76 - 297
Target Start/End: Complemental strand, 32011764 - 32011542
Alignment:
| Q |
76 |
cattgaaccaaacagagccttatagattctcatttattgcttcccttccaaattctagnnnnnnnnnnc-cggatggaaggtgtgcaattaatattttac |
174 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32011764 |
cattgaatcaaacagagccttatagattctcatttattgattcccttccaaattctagtttttttttttacggatggaaggtgtgcaattaatattttac |
32011665 |
T |
 |
| Q |
175 |
gaaataagcacaatatgattactctgctcaaggaagggctatgcgatgaagttttaggtttatatatttggtcatacattaaaatgatctctcggatggt |
274 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| || | |||| |
|
|
| T |
32011664 |
gaaataagcacaatatgattacgctgctcaaggaagggctatgcgatgaagttttaggtttatatatttggtcatacactgaaatgatctttcaggtggt |
32011565 |
T |
 |
| Q |
275 |
atttatagctctacgtatccttc |
297 |
Q |
| |
|
|||||||||||||| | |||||| |
|
|
| T |
32011564 |
atttatagctctacttgtccttc |
32011542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University