View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_96 (Length: 306)
Name: NF1404_high_96
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_96 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 71 - 249
Target Start/End: Original strand, 41897155 - 41897333
Alignment:
| Q |
71 |
gtcagaagccaccaagtgataatattcatatcaccagatatttgtcccccaagacggacttcagtggtagtttcataattttcttacatattcttcttct |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41897155 |
gtcagaagccaccaagtgataatattcatatcaccagatatttgtcccccaagacgtacttcagtggtagtttcataattttcttacatattcttcttct |
41897254 |
T |
|
| Q |
171 |
tttaaccgattaaccgctaatatttatctaaataaaaatacagaagatattctcctctttccgttattgtttataacac |
249 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41897255 |
tttaaccaattaaccgctaatatttatctaaataaaaatacagaagatattcccctctttccgttattgtttataacac |
41897333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University