View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_97 (Length: 305)
Name: NF1404_high_97
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_97 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 30 - 296
Target Start/End: Original strand, 4072319 - 4072586
Alignment:
| Q |
30 |
aactttgcatgcttctcattcaacttgtggcaccttctattattgtctaaaccatgttgtcgaaaccttataaacaaccaattaggatgaggatgaacac |
129 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4072319 |
aactctgcatgcttctcattcaacttgtggcaccttctattattgtctaaactatgttttcaaaaccctataaacaaccaattaggatgaggatgaacac |
4072418 |
T |
|
| Q |
130 |
cannnnnnnnnnnnnnnn-atcttcttgatagggtcgatcattaaaatctcctatgacacaccaatgaagcgaggacatatcacttaaactctcataaca |
228 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4072419 |
cttttttttttttttttttatcttcttgatagggtcgatcattaaaatctcctataatacaccaatgaagcgaggacatatcacttaaactctcataaca |
4072518 |
T |
|
| Q |
229 |
aattacatgcctctcttcaacggttgcatagtggataaccataatagcatgttaacctccattctctc |
296 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4072519 |
aattgcatgcctctcttcaacggttgcatagtggataaccataatagcatgttaacctccattctctc |
4072586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University