View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_high_99 (Length: 296)
Name: NF1404_high_99
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_high_99 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 53 - 222
Target Start/End: Original strand, 40769019 - 40769181
Alignment:
| Q |
53 |
agataatacttcatatcaggatagactcattctagtatttgatgatgtagtattttcttgctcaatagttctgtacactcactatgatctttgtattata |
152 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40769019 |
agataataattcatatcaggatagactcattctagtatttgatgatgtagtattttcttgctcaatagttctgtacactcactatgatctttgta----- |
40769113 |
T |
 |
| Q |
153 |
atttatagtgtttagctaataatgaacgttcatttcatttaagttcttaacataaccaggaggaaaaggt |
222 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40769114 |
--ttatagtgtttagctaataatgaactttcatttcatttaagttcttaacataaccaggaggaaaaggt |
40769181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University