View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_103 (Length: 334)
Name: NF1404_low_103
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_103 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 43142562 - 43142752
Alignment:
| Q |
1 |
ttttgctcttacattctcttatgaaaatacgtggttcataagagaatgtgcgaacattaacaatgatggttgaagtgagttaaaaggggacaatcatag- |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
43142562 |
ttttgctcttacattctcttatgaaaataagtggttcataagagaatgtgtgaacattaacaatgatggttgaaatgagttaaaaggggacaaccataga |
43142661 |
T |
 |
| Q |
100 |
--aaagagaggagtggcaaagagaacaaaaccatgctacgtactaataccatcaattagtgttctcaaacaaagtgcgttcaattgtgtaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43142662 |
ataaagagaggagtggcaaagagaacaaaaccatgctatgtactaataccatcaattagtgttctcaaacaaattgcgttcaattgtgtaa |
43142752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 213 - 248
Target Start/End: Original strand, 43142744 - 43142779
Alignment:
| Q |
213 |
attgtgcaatttaatccacgtaattttgttcatgag |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43142744 |
attgtgtaatttaatccacgtaattttgttcatgag |
43142779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University