View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_104 (Length: 333)
Name: NF1404_low_104
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_104 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 24 - 282
Target Start/End: Original strand, 43142286 - 43142544
Alignment:
| Q |
24 |
tcatcacatatcttcatccggaatatgttttaacctattaaaaccaatggtactaatgataacatgtcttcatcaatgggctgtgcatggttaaccaaac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142286 |
tcatcacatatcttcatccggaatatgttttaacctattaaaaccaatggtactaatgataacatgtcttcatcaatgggctgtgcatggttaaccaaac |
43142385 |
T |
|
| Q |
124 |
catataacccaatattttttggttaaggttcatataccaaaccattatttggaaaacaccggattatgcttcggaagcggtctgggccggtttagaacag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
43142386 |
catataacccaatattttttggttaaggttcatataccaaaccattatttggaaaacaccgaattatgcttcggaagcggtttgggccggtttagaaccg |
43142485 |
T |
|
| Q |
224 |
gttccattatatttgattttcagtcgttaaattcggctgagtgctaccacaaccctctc |
282 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||| |
|
|
| T |
43142486 |
gttccattatatttgattttcagtcattaatttcggttgagtgctaccacaaccctctc |
43142544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University