View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_106 (Length: 325)
Name: NF1404_low_106
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_106 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 99 - 298
Target Start/End: Original strand, 54985928 - 54986127
Alignment:
| Q |
99 |
ttcttctatcatagtagattgaggtgatattggatgctgaatctgtattttgtttgactgatcttatctacgtttcagggtttatgggggctatgatatc |
198 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
54985928 |
ttcttctatcatagtagattgagttgatataggatgctgaatctgtattttgtttgactgatcttatctatgtttcagggtttatgggggctatgatatc |
54986027 |
T |
 |
| Q |
199 |
caatgtggcctttgtgtttaggaatatattctcaaagaagggaatgaaaggaatgtctgttagtggaatgaactactatgcttgtctctccatattatct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54986028 |
caatgtggcctttgtgtttaggaatatattctcaaagaagggaatgaaaggaatgtctgttagtggaatgaactactatgcttgtctctccatattatct |
54986127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 170 - 285
Target Start/End: Original strand, 7883510 - 7883625
Alignment:
| Q |
170 |
gtttcagggtttatgggggctatgatatccaatgtggcctttgtgtttaggaatatattctcaaagaagggaatgaaaggaatgtctgttagtggaatga |
269 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||| |||| ||||| ||||||||||||||||||||||| |||||||| |||||| |||||||||||||| |
|
|
| T |
7883510 |
gtttcaggatttatgggagctatgatatcaaatttggcatttgtatttaggaatatattctcaaagaaaggaatgaatggaatgagtgttagtggaatga |
7883609 |
T |
 |
| Q |
270 |
actactatgcttgtct |
285 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
7883610 |
actattatgcttgtct |
7883625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 172 - 283
Target Start/End: Original strand, 18396534 - 18396645
Alignment:
| Q |
172 |
ttcagggtttatgggggctatgatatccaatgtggcctttgtgtttaggaatatattctcaaagaagggaatgaaaggaatgtctgttagtggaatgaac |
271 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| |||| |||||||| | || || ||||| || ||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
18396534 |
ttcaggttttatgggggctatgatatcaaatctggcatttgtgttccgcaacatcttctcgaaaaaggggatgaagggaaagtctgttagtggaatgaat |
18396633 |
T |
 |
| Q |
272 |
tactatgcttgt |
283 |
Q |
| |
|
|||||||||||| |
|
|
| T |
18396634 |
tactatgcttgt |
18396645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University