View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_120 (Length: 306)
Name: NF1404_low_120
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_120 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 98 - 220
Target Start/End: Original strand, 19190429 - 19190551
Alignment:
| Q |
98 |
gttatggcgctaatgaccgttatgagagtggatatgggcgttctgggggtggatatggtgatggagggcgtacgagtattggtggatatggcgaagaaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19190429 |
gttatggcgctaatgaccgttatgagagtggatatgggcgttctggtggtggatatggtgatggagggcgttcgagtattggtggatatggcgaagaaaa |
19190528 |
T |
|
| Q |
198 |
ccgttctagtggtggctaaggat |
220 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
19190529 |
ccgttctagtggtggctatggat |
19190551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University