View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_126 (Length: 296)
Name: NF1404_low_126
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_126 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 61 - 289
Target Start/End: Complemental strand, 32165600 - 32165372
Alignment:
| Q |
61 |
gctttaactggttttcaaatttttgcttgttaaatgtacttgaacattgtattttgtatgcttttgaagttttgtattctaatttcaaaatatggcaata |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165600 |
gctttaactggttttcaaatttttgcttgttaaatgtacttgaatattgtattttgtatgcttttgaagttttgtattctaatttcaaaatatggcaata |
32165501 |
T |
|
| Q |
161 |
gattttttaatgttttgcttccattagcagcaaacctgtgatatagttaaagacttgtctattttgatgtttattgtcattttaggaagtaatgtgaaac |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165500 |
gattttttaatgttttgcttccattagcagcaaacctgtgacatagttaaagacttgtctattttgatgtttattgtcattttaggaagtaatgtgaaac |
32165401 |
T |
|
| Q |
261 |
tataaattttaagaattttgcctttgctt |
289 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
32165400 |
tataaattttaagagttttgcctttgctt |
32165372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University