View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_131 (Length: 282)
Name: NF1404_low_131
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_131 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 22 - 246
Target Start/End: Complemental strand, 40461427 - 40461203
Alignment:
| Q |
22 |
aatatggaggtaattccaagtcaactttttcgatttaatcgattgaactgagaatatactagttagttagttggtttaatctcgattgtattgtagtctg |
121 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40461427 |
aatatggaggtaattccaagccaactttttcgatttaatcgattgaactgagaatatactagttagttagttggtttaatctcgattgtattgtagtctg |
40461328 |
T |
|
| Q |
122 |
attgaatcaagttaatctaagattgaaccgcattaaatcggttgaatcgcggttgattcaattaatttttattttgtgtattcttttattgaaccataac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40461327 |
attgaatcaagttaatctaagattgaaccgcattaaatcggttgaatcgcggttgattcaattaatttttattttgtgtattcttttattgaaccataac |
40461228 |
T |
|
| Q |
222 |
ccgaattttcaccggttcttcaaga |
246 |
Q |
| |
|
|| |||||||||||||||||||||| |
|
|
| T |
40461227 |
cctaattttcaccggttcttcaaga |
40461203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University