View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_138 (Length: 267)
Name: NF1404_low_138
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_138 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 30 - 253
Target Start/End: Complemental strand, 44490 - 44267
Alignment:
| Q |
30 |
aaagtaaaagtggaactctgactctgtacacaacataaccgccgaatcattcttctttctcacctgcctctgttctagacttcgtattgtttgttatcac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44490 |
aaagtaaaagtggaactctgactctgtacacaacataaccgccgaatcattcttctttctcacctgcctctgttctagacttcgtattgtttgttatcac |
44391 |
T |
|
| Q |
130 |
tccagttatccaactttatctcatagatcttcaacacgtggcaatttaaactttcatcggctgagattagaagtacgatgcccgtatacgagctaattaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44390 |
tccagttatccaactttatctcatagatcttcaacacgtggcaatttaaactttcatcggctgagattagaagtacgatgcccgtatacgagctaattaa |
44291 |
T |
|
| Q |
230 |
ccatctaaaacctttacacctttg |
253 |
Q |
| |
|
|||||||||||| || |||||||| |
|
|
| T |
44290 |
ccatctaaaacccttgcacctttg |
44267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University