View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_141 (Length: 257)
Name: NF1404_low_141
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_141 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 29 - 257
Target Start/End: Original strand, 9608954 - 9609178
Alignment:
| Q |
29 |
atatagcatatgtactttgatactattattcaaatttaatttgtgtgttttaacaaaattaaaattgctccatttttgccacatttgaggaaagagtacc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9608954 |
atatagcatatgtactttgatactattattcaaatttaatttgtgtgttttaacaaaattaaaattgctccatttttgccacatttgaggaaagagtacc |
9609053 |
T |
 |
| Q |
129 |
tcgtgacatataataggaccacaaaatgaacacatacatattaatcagttaagacatgaggtgtctcagccagcatccccacattttttgagttcacact |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9609054 |
tcgtgacatataataggaccacaaaatgaacacatacatattaatcagttaagacatgaggtgtct----cagcatccccacattttttgagttcacact |
9609149 |
T |
 |
| Q |
229 |
cttcacctagttaacctttctttaagcta |
257 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9609150 |
cttcacctagttaacctttctttaagcta |
9609178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University