View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_145 (Length: 252)
Name: NF1404_low_145
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_145 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 45524583 - 45524457
Alignment:
| Q |
1 |
accttctttgtctatggttctctctgttgcctccagatcatttagataacctgcatttcacttgttcatacatagttaatacaaatttttcataattcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45524583 |
accttctttgtctatggttctctctgttgcctccagatcatttagataacctgcatttcacttgttcatacatagttaatacaaatttttcataattcat |
45524484 |
T |
 |
| Q |
101 |
ttattaaatcatggctatttatttctt |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45524483 |
ttattaaatcatggctatttatttctt |
45524457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 156 - 239
Target Start/End: Complemental strand, 45524407 - 45524324
Alignment:
| Q |
156 |
attggtatatgaaagtggagctgaattgttttgtttggagtcaaagacatcccatgaatgaagagatgacacttcaacctacct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45524407 |
attggtatatgaaagtggagctgaattgttttgtttggagtcaaagacatcccatgaatgaagagatgacacttcaacctacct |
45524324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University