View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_147 (Length: 251)
Name: NF1404_low_147
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_147 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 9609395 - 9609612
Alignment:
| Q |
1 |
cattactcaacatattactctctcaatcggacttgaaggttatacaacccgcacnnnnnnnntgtgccttctttcaatattattaatttcttatagtata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9609395 |
cattactcaacatattactctctcaatcgggctcgaaggttatacaaccggcacaaaaaaaatgtgtcttctttcaatattattaatttcttatagtata |
9609494 |
T |
 |
| Q |
101 |
tttgataaatagactaactcgttcttagagtcaaataagcttgatgtttaggtcaaacaagactaaaacaagaacctgatctatttaagacaagaacaaa |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| | | |
|
|
| T |
9609495 |
tttgataaatagattaactcgttcttagagtcaaacaagcttgatgtttaggtcaaacaagactaaaacaagaacttgatctatttaagataagatcgag |
9609594 |
T |
 |
| Q |
201 |
tggatccagagacaatgt |
218 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
9609595 |
tggatccaaagacaatgt |
9609612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University