View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_151 (Length: 251)
Name: NF1404_low_151
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_151 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 251
Target Start/End: Complemental strand, 14625978 - 14625744
Alignment:
| Q |
19 |
ggtaaaataagacccgatccatagattcaacccatttcatagtgattccaatccctaattcccacttcttcctcctcttttacgatctttcatttcccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14625978 |
ggtaaaataagacccgatccatagattcaacccatttcatagtgattccaatccctaattcccacttcttcctcctcttttacgatctttcatttcccaa |
14625879 |
T |
|
| Q |
119 |
ctttcttcttcttctcacaacacaacacaaagatcctgct--tctgtaagaccattcttcagtcggaaaattcatcctccttcactttcttccacgttcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14625878 |
ctttcttcttcttctcacaacacaacacaaagatcctgcttctctgtaagaccattcttcagtcggaaaattcatcctccttcactttcttccacgttcc |
14625779 |
T |
|
| Q |
217 |
tccgacaccaccaaacacccctcataagcttcttt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14625778 |
tccgacaccaccaaacacccctcataagcttcttt |
14625744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University