View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_152 (Length: 246)
Name: NF1404_low_152
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_152 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 20 - 161
Target Start/End: Complemental strand, 51352327 - 51352185
Alignment:
| Q |
20 |
gatgaagttcctgaacaactacaacggggttacgcaattttaatgtgtagacaattgagtctacacttgagagggggtagctcac-aattgaatatgaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51352327 |
gatgaagttcctgaacaactacaacggggttacgcaattttaatgtgtagacaattgagtctacacttgagagggggtagctcacaaattgaatatgaat |
51352228 |
T |
|
| Q |
119 |
gaatattacagatttgcataaaatatctatatttcggtctctg |
161 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||| |||||| |
|
|
| T |
51352227 |
gaatattacggatttgcataaaatatctatatctcgatctctg |
51352185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 42813621 - 42813554
Alignment:
| Q |
167 |
ccacatgaggattaaaaccaataggccaacgcaacattgtaatcacattgtacaccgacttgtattca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42813621 |
ccacatgaggattaaaaccaataggccaacgcaacattgtaatcacattgtacaccgacttgtattca |
42813554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University