View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_154 (Length: 241)
Name: NF1404_low_154
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_154 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 28748149 - 28747953
Alignment:
| Q |
1 |
tcttgctcttgctggagtgcagccacctatttgcatgaaattcttgtctagagcagcaaatgctaaggttgataagttcttaggatcttgaagttgtctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28748149 |
tcttgctcttgctggagtgcagccacctatttgcatgaaattcttgtctagagcagcaaatgctaaggttgataatttcttaggatcttgaagttgtctt |
28748050 |
T |
 |
| Q |
101 |
attggatctcataaacaacaatggaaaacaagtatataggcacaatgtaatttaggcacaatgtaatttagaacctagtattcttttataccttttgat |
199 |
Q |
| |
|
||||||||||||| | ||||||||||||||| | | | || | || ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28748049 |
attggatctcatacaaaacaatggaaaacaa-tcttcaacca-gctcatatataggcacaatgtaatttagaacctaatattcttttataccttttgat |
28747953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 28752162 - 28752090
Alignment:
| Q |
1 |
tcttgctcttgctggagtgcagccacctatttgcatgaaattcttgtctagagcagcaaatgctaaggttgat |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28752162 |
tcttgctcttgctggagtgcagccacctatttgcatgaaattcttgtctagagcagcaaatgctaaggttgat |
28752090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 28738198 - 28738126
Alignment:
| Q |
1 |
tcttgctcttgctggagtgcagccacctatttgcatgaaattcttgtctagagcagcaaatgctaaggttgat |
73 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
28738198 |
tcttgctcttgctggagtgaagccacctatttgtatgaaattcttgtctaaagcaaaaaatgctaaagttgat |
28738126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 39944747 - 39944877
Alignment:
| Q |
1 |
tcttgctcttgctggagtgcagccacctatttgcatgaaattcttgtctagagcagcaaatgctaaggttgataagttcttaggatcttgaagttgtctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||| | | |
|
|
| T |
39944747 |
tcttgctcttgctggagtgcagccacctatttgtatgaaattcttgtctagagcagcaaatgctaaggttgatggcttcttagaatcttaaagttgacct |
39944846 |
T |
 |
| Q |
101 |
attggatctcataaacaacaatggaaaacaa |
131 |
Q |
| |
|
|||||||||| | ||||||||||||||||| |
|
|
| T |
39944847 |
gttggatctcagacacaacaatggaaaacaa |
39944877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 39957760 - 39957890
Alignment:
| Q |
1 |
tcttgctcttgctggagtgcagccacctatttgcatgaaattcttgtctagagcagcaaatgctaaggttgataagttcttaggatcttgaagttgtctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||| | | |
|
|
| T |
39957760 |
tcttgctcttgctggagtgcagccacctatttgtatgaaattcttgtctagagcagcaaatgctaaggttgatggcttcttagaatcttaaagttgacct |
39957859 |
T |
 |
| Q |
101 |
attggatctcataaacaacaatggaaaacaa |
131 |
Q |
| |
|
|||||||||| | ||||||||||||||||| |
|
|
| T |
39957860 |
gttggatctcagacacaacaatggaaaacaa |
39957890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University