View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_157 (Length: 232)
Name: NF1404_low_157
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_157 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 232
Target Start/End: Original strand, 26335840 - 26336053
Alignment:
| Q |
19 |
ggtgcttcctcttatatgttgtgcagcaaagtatttgggattgagatcaccaatcattcacaaattatggtataacaacatagtgcctgaacatgatttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26335840 |
ggtgcttcctcttatatgttgtgcagcaaagtatttgggattgagatcaccaatcattcacaaattatggtataacaacatagtgcctgaacatgatttg |
26335939 |
T |
|
| Q |
119 |
aagtatgggatgaactttgcatatggtggtacaggtgtatttgatacattttcttcatgaccaaatactaccacccaaatttcttccttcacccaattca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||| |||| ||| |
|
|
| T |
26335940 |
aagtatgggatgaactttgcatatggtggtacaggtgtatttgatacattttcttcatgaccaaatatgacaacccaaattgattccttcaaccaagtca |
26336039 |
T |
|
| Q |
219 |
tccaacaaaatgtc |
232 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
26336040 |
tccaaaaaaatgtc |
26336053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 21 - 184
Target Start/End: Original strand, 26328131 - 26328294
Alignment:
| Q |
21 |
tgcttcctcttatatgttgtgcagcaaagtatttgggattgagatcaccaatcattcacaaattatggtataacaacatagtgcctgaacatgatttgaa |
120 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||||| ||||||||||| |||||| |||||| ||| || | ||||||| | ||||||||||| |
|
|
| T |
26328131 |
tgcttcctcttttatattgtgcagccaagtatttgggattgaaatcaccaatcactcacaatttatggaatactaatacagtgcctaagcatgatttgaa |
26328230 |
T |
|
| Q |
121 |
gtatgggatgaactttgcatatggtggtacaggtgtatttgatacattttcttcatgaccaaat |
184 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| | || |||| || |||||||| |
|
|
| T |
26328231 |
gtatgggatgaactttgcctatggtggtacaggtgtatttgaaatatcttctacaggaccaaat |
26328294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 39 - 232
Target Start/End: Original strand, 26322849 - 26323036
Alignment:
| Q |
39 |
gtgcagcaaagtatttgggattgagatcaccaatcattcacaaattatggtataacaacatagtgcctgaacatgatttgaagtatgggatgaactttgc |
138 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||| ||||||||| || ||||| ||| || ||||| ||||||||||||||||||||||||| |
|
|
| T |
26322849 |
gtgcagccaagtatttgagattgagatcaccaatccctcacaaattcagg------aacattgtgtctaaacattatttgaagtatgggatgaactttgc |
26322942 |
T |
|
| Q |
139 |
atatggtggtacaggtgtatttgatacattttcttcatgaccaaatactaccacccaaatttcttccttcacccaattcatccaacaaaatgtc |
232 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||||||| || ||||||| |||||||| |||| |||| ||| |||||||| |
|
|
| T |
26322943 |
atatggtggcacaggtgtatttgatacatttacttcaggaccaaatatgacagcccaaatcgattccttcaaccaactcattcaagaaaatgtc |
26323036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 114 - 165
Target Start/End: Complemental strand, 42224184 - 42224133
Alignment:
| Q |
114 |
atttgaagtatgggatgaactttgcatatggtggtacaggtgtatttgatac |
165 |
Q |
| |
|
||||||| ||||| ||||||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
42224184 |
atttgaaatatggaatgaactttgcatttggtggtactggtgtgtttgatac |
42224133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University