View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_163 (Length: 222)
Name: NF1404_low_163
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_163 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 41562923 - 41563126
Alignment:
| Q |
1 |
tataaggctgttgaagatggtggatcttctgattcaaattgcaaattgtttatacaaga--aattgtagagaaaagttcataatcaatgattaagcatac |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41562923 |
tataaggctgttgaagatggtggatcttctgattcaaattgcaaattgtttatacaagagaaattgtagagaaaagttcataatcaat-attaagcatac |
41563021 |
T |
 |
| Q |
99 |
caaaatagttctattgtgacaatagattatgtcatcagagactaatttataaaagacttgactttacaaatttaaagtgacaaataagtctttaatgatg |
198 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41563022 |
caaaaaagttctattgtgacaatagattatgtcatcagagactaatttataaaagacttgactttacaaatttaaagtgacacataagtctttaatgatg |
41563121 |
T |
 |
| Q |
199 |
atgtc |
203 |
Q |
| |
|
||||| |
|
|
| T |
41563122 |
atgtc |
41563126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 12 - 81
Target Start/End: Original strand, 46657195 - 46657264
Alignment:
| Q |
12 |
tgaagatggtggatcttctgattcaaattgcaaattgtttatacaagaaattgtagagaaaagttcataa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
46657195 |
tgaagatggtggatcttctgattcaaattgcaaattgtttatacaagaaattgtagagcaaagctcataa |
46657264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University