View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_168 (Length: 211)
Name: NF1404_low_168
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_168 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 36154102 - 36153928
Alignment:
| Q |
17 |
atactaatgcttattattgcttgatgttgttgtggaggaagaggggagaaagggttggcttttatagtttagggggatggaaattattgattggttaatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36154102 |
atactaatgcttattattgcttgatgttgctgtggaggaagaggggagaaagggttggcttttatagtttagggggatggaaattattgattggttaatt |
36154003 |
T |
|
| Q |
117 |
aggtgcaatgttttgtcagaaaggtgcagtttctgatagaacaaatcttctttgtctgtcatggaaaggtggtgt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36154002 |
aggtgcaatgttttgtcagaaaggtgcagtttctgatagaacaaatcttctttgtctgtcatggaaaggtggtgt |
36153928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 33 - 141
Target Start/End: Complemental strand, 36150696 - 36150588
Alignment:
| Q |
33 |
ttgcttgatgttgttgtggaggaagaggggagaaagggttggcttttatagtttagggggatggaaattattgattggttaattaggtgcaatgttttgt |
132 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
36150696 |
ttgcttggtggtgttgtggaggaagaggggagaaagggttggcttttatagtttagggagatggaaattaatgattggttaattaggtgcaatgttttat |
36150597 |
T |
|
| Q |
133 |
cagaaaggt |
141 |
Q |
| |
|
||||||||| |
|
|
| T |
36150596 |
cagaaaggt |
36150588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University