View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_169 (Length: 211)
Name: NF1404_low_169
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_169 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 191
Target Start/End: Complemental strand, 36154108 - 36153928
Alignment:
| Q |
11 |
tagattatactaatgcttattattgcttgatgttgttgtggaggaagaggggagaaagggttggcttttatagtttagggggatggaaattattgattgg |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36154108 |
tagagtatactaatgcttattattgcttgatgttgctgtggaggaagaggggagaaagggttggcttttatagtttagggggatggaaattattgattgg |
36154009 |
T |
 |
| Q |
111 |
ttaattaggtgcaatgttttgtcagaaaggtgcagtttctgatagaacaaatcttctttgtctgtcatggaaaggtggtgt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36154008 |
ttaattaggtgcaatgttttgtcagaaaggtgcagtttctgatagaacaaatcttctttgtctgtcatggaaaggtggtgt |
36153928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 33 - 141
Target Start/End: Complemental strand, 36150696 - 36150588
Alignment:
| Q |
33 |
ttgcttgatgttgttgtggaggaagaggggagaaagggttggcttttatagtttagggggatggaaattattgattggttaattaggtgcaatgttttgt |
132 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
36150696 |
ttgcttggtggtgttgtggaggaagaggggagaaagggttggcttttatagtttagggagatggaaattaatgattggttaattaggtgcaatgttttat |
36150597 |
T |
 |
| Q |
133 |
cagaaaggt |
141 |
Q |
| |
|
||||||||| |
|
|
| T |
36150596 |
cagaaaggt |
36150588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University