View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_174 (Length: 210)
Name: NF1404_low_174
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_174 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 9 - 67
Target Start/End: Original strand, 52068799 - 52068857
Alignment:
| Q |
9 |
acaagtccctaactaagttaagctattttctttaaatgttgcagaataatctacccacc |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
52068799 |
acaagtccctaactaagttaagctattttctttaaatgttgcataataataaacccacc |
52068857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University