View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1404_low_175 (Length: 210)

Name: NF1404_low_175
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1404_low_175
NF1404_low_175
[»] chr4 (1 HSPs)
chr4 (9-51)||(52068799-52068841)


Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 51
Target Start/End: Original strand, 52068799 - 52068841
Alignment:
9 acaagtccctaactaagttaagctattttctttaaatgttgca 51  Q
    |||||||||||||||||||||||||||||||||||||||||||    
52068799 acaagtccctaactaagttaagctattttctttaaatgttgca 52068841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University