View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_176 (Length: 210)
Name: NF1404_low_176
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_176 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 51
Target Start/End: Original strand, 52068799 - 52068841
Alignment:
| Q |
9 |
acaagtccctaactaagttaagctattttctttaaatgttgca |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52068799 |
acaagtccctaactaagttaagctattttctttaaatgttgca |
52068841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University