View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_182 (Length: 205)
Name: NF1404_low_182
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_182 |
 |  |
|
| [»] scaffold0573 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0573 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: scaffold0573
Description:
Target: scaffold0573; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 10118 - 9946
Alignment:
| Q |
16 |
ttgttctgtctccggattatgcaacttcatccttttgtttagacgaactttgtcatatccttaaatgcataaagggaaggggtcgatttgtttggccaat |
115 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
10118 |
ttgttctctctccgagttatgcaacttcgtccttttgtttagacgaactttgtcatatccttaaatgcatacatggaaggggacgatttgtttggccaat |
10019 |
T |
 |
| Q |
116 |
cttttatgaagttgacccttcaattgtgaggtggtcagaagaaggaacgtatggagaagcaatggctaaacat |
188 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10018 |
cttttatgacgttgacccttcaattgtgagatggtcagaagaaggaacgtatggagaagcaatggctgaacat |
9946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 28899676 - 28899848
Alignment:
| Q |
16 |
ttgttctgtctccggattatgcaacttcatccttttgtttagacgaactttgtcatatccttaaatgcataaagggaaggggtcgatttgtttggccaat |
115 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
28899676 |
ttgttctctctccgagttatgcaacttcgtccttttgtttagacgaactttgtcatatccttaaatgcatacatggaaggggacgatttgtttggccaat |
28899775 |
T |
 |
| Q |
116 |
cttttatgaagttgacccttcaattgtgaggtggtcagaagaaggaacgtatggagaagcaatggctaaacat |
188 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28899776 |
cttttatgacgttgacccttcaattgtgagatggtcagaagaaggaacgtatggagaagcaatggctgaacat |
28899848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 30005 - 30189
Alignment:
| Q |
1 |
caaaggcagcaatcgttgttctgtctccggattatgcaacttcatccttttgtttagacgaactttgtcatatccttaaatgcataaagggaaggggtcg |
100 |
Q |
| |
|
||||||| || || |||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
30005 |
caaaggcggccattgttgttctctctccgagttatgcaacttcatctttttgtttagacgaactttgtcatatccttaaatgcatagagggaaggggtgg |
30104 |
T |
 |
| Q |
101 |
atttgtttggccaatcttttatgaagttgacccttcaattgtgaggtggtcagaagaaggaacgtatggagaagcaatggctaaacat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||| |||||| || |||||||||||||||||| ||||| |
|
|
| T |
30105 |
atttgtttggccaatcttttatgaagttgacccttcaaaagtgagatggttagaaga---cacttatggagaagcaatggctgaacat |
30189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 65589 - 65773
Alignment:
| Q |
1 |
caaaggcagcaatcgttgttctgtctccggattatgcaacttcatccttttgtttagacgaactttgtcatatccttaaatgcataaagggaaggggtcg |
100 |
Q |
| |
|
||||||| || || |||||||| |||||| ||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
65589 |
caaaggcggccattgttgttctctctccgagttatgcaacttcatctttttgtttagacgaactttgtcatattcttaaatgcataaagggaaggggtcg |
65688 |
T |
 |
| Q |
101 |
atttgtttggccaatcttttatgaagttgacccttcaattgtgaggtggtcagaagaaggaacgtatggagaagcaatggctaaacat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||| |||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
65689 |
atttgtttggccaatcttttatgaagttgaaccttcacatgtgagatggttggaaga---gagttatggagaagcaatggctaaacat |
65773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University