View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_184 (Length: 203)
Name: NF1404_low_184
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_184 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 4195195 - 4195125
Alignment:
| Q |
1 |
tgtttttgaagttcttgcaatgaaatgtaggttggttttagcaacggttcagtttgtgttaccattgtgta |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195195 |
tgtttttgaagttcttgcaatgaaatgtaggttggttttagcaacggttcagtttgtgttaccattgtgta |
4195125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 4186175 - 4186137
Alignment:
| Q |
1 |
tgtttttgaagttcttgcaatgaaatgtaggttggtttt |
39 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
4186175 |
tgtttttggagttcttgcagtgaaatgtaggttggtttt |
4186137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University