View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1404_low_34 (Length: 422)

Name: NF1404_low_34
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1404_low_34
NF1404_low_34
[»] chr4 (1 HSPs)
chr4 (273-307)||(35121303-35121337)


Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 273 - 307
Target Start/End: Complemental strand, 35121337 - 35121303
Alignment:
273 acattttccaaccgagtgcagaaatatatgaaagg 307  Q
    |||||||||||||||||||||||||||||||||||    
35121337 acattttccaaccgagtgcagaaatatatgaaagg 35121303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University