View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_74 (Length: 382)
Name: NF1404_low_74
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 267
Target Start/End: Complemental strand, 35121337 - 35121303
Alignment:
| Q |
233 |
acattttccaaccgagtgcagaaatatatgaaagg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35121337 |
acattttccaaccgagtgcagaaatatatgaaagg |
35121303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University