View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_92 (Length: 361)
Name: NF1404_low_92
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_92 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 29 - 353
Target Start/End: Complemental strand, 49905367 - 49905043
Alignment:
| Q |
29 |
agtagtcaattgtcacattgttaattctaggacaaaaggaccaaaaacttgggcatcagggtaaagaattttcgataaataggtataggaaagtaacttg |
128 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49905367 |
agtagtcagttgtcacattgttaattctaggacaaaaggaccaaaaacttgggcatcagggtaaagaattttcgataaataggtataggaaagtaacttg |
49905268 |
T |
 |
| Q |
129 |
tgcataatgttaatgtacaatacaatacaagtcccagggtgagagaatcagtgtcatcatattctnnnnnnnnnnnnnaatactcataacatcatttact |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49905267 |
tgcataatgttaatgtacaatacaatacaagtcccagggtgagagaatcagtgtcatcatattctcccccaaccccccaatactcataacatcatttact |
49905168 |
T |
 |
| Q |
229 |
cttgcagagtggggggccaaagctcttttctgttttaggggtcccctgcatttttaagggagaatatgttcttttcattttggctttcaattccctattt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49905167 |
cttgcagagtggggggccaaagctcttttctgttttaggggtcccctgcatttttaagggagaatatgttcttttcattttggctttcaattccctattt |
49905068 |
T |
 |
| Q |
329 |
tgatgaataccagtctattcatctc |
353 |
Q |
| |
|
|||||||||||| ||||||| |||| |
|
|
| T |
49905067 |
tgatgaataccaatctattcttctc |
49905043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University