View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1404_low_95 (Length: 355)
Name: NF1404_low_95
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1404_low_95 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 30 - 304
Target Start/End: Original strand, 43142270 - 43142544
Alignment:
| Q |
30 |
ctaataatattgtacatcatcacatatcttcatccggaatatgttttaacctattaaaaccaatggtactaatgataacatgtcttcatcaatgggctgt |
129 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142270 |
ctaataatgttgtacctcatcacatatcttcatccggaatatgttttaacctattaaaaccaatggtactaatgataacatgtcttcatcaatgggctgt |
43142369 |
T |
 |
| Q |
130 |
gcatggttaaccaaaccatataacccaatattttttggttaaggttcatataccaaaccattatttggaaaacaccggattatgcttcggaagcggtctg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
43142370 |
gcatggttaaccaaaccatataacccaatattttttggttaaggttcatataccaaaccattatttggaaaacaccgaattatgcttcggaagcggtttg |
43142469 |
T |
 |
| Q |
230 |
ggccggtttagaacaggttccattatatttgattttcagtcgttaaattcggctgagtgctaccacaaccctctc |
304 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||| |
|
|
| T |
43142470 |
ggccggtttagaaccggttccattatatttgattttcagtcattaatttcggttgagtgctaccacaaccctctc |
43142544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University