View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14050_high_3 (Length: 348)
Name: NF14050_high_3
Description: NF14050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14050_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 25 - 340
Target Start/End: Complemental strand, 39901396 - 39901088
Alignment:
| Q |
25 |
gagggaagattggttacacatgaaactgaaaatacatagatatataataataacactagctaggtacgtaatacgtagcacatgtattgtgaattagtgc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
39901396 |
gagggaagattggttacacatgaaactgaaaatacatagatatataataataacactagctaggtacgta-------gcacatgtatcgtgaattagtgc |
39901304 |
T |
|
| Q |
125 |
tagtaatttatttgtgattgatgcagtcgttaaaacttaggatgctaatgcatggggtttgttcaacaattcctggtgcaaaagcagcggcgacggaagc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39901303 |
tagtaatttatttgtgattgatgcagtcgttaaaacttaggatgctactgcatggggtttgttcaacaattcctggtgcaaaagcagcggcgacggaagc |
39901204 |
T |
|
| Q |
225 |
ctcgacaatcaccaccagtgaaaccttcacctctgcataccgatgcacagttgctgtcacgtgaacatggacccttaaacttgtggctcttagactcgca |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39901203 |
ctcgacaatcaccaccagtgaaaccttcacctctgcataccgatgcacagttgctgtcacgtgaacatggacccttaaacttgtggctcttagactcgca |
39901104 |
T |
|
| Q |
325 |
ccttcgaccctatgct |
340 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
39901103 |
ccttcgaccctctgct |
39901088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 186 - 340
Target Start/End: Complemental strand, 39905079 - 39904925
Alignment:
| Q |
186 |
ttcaacaattcctggtgcaaaagcagcggcgacggaagcctcgacaatcaccaccagtgaaaccttcacctctgcataccgatgcacagttgctgtcacg |
285 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||| || ||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
39905079 |
ttcaacaatttctggtgcaaaagcagcggtgacggacaccccgacaatcaccaccaatgaaaccttcacccctgcataccgatccacagttgctgtcact |
39904980 |
T |
|
| Q |
286 |
tgaacatggacccttaaacttgtggctcttagactcgcaccttcgaccctatgct |
340 |
Q |
| |
|
|||||| |||||||||||||| |||| ||| || ||||||||||||| |||| |
|
|
| T |
39904979 |
cacacatggtcccttaaacttgtgactctgagattcacaccttcgaccctctgct |
39904925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University