View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14050_low_10 (Length: 208)
Name: NF14050_low_10
Description: NF14050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14050_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 8 - 191
Target Start/End: Complemental strand, 33818703 - 33818518
Alignment:
| Q |
8 |
cacatgtggtcaaacttca-caagctgttataaccacctaa-ttgcaatgtttcaaacacgttaaaagccttacgattatagttaggtataaacaaaaaa |
105 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33818703 |
cacaggtggtcaaacttcaacaagctgttataaccacctaaattgcaatgcttgaaacacgttaaaagccttacgattatagttaggtataaacaaaata |
33818604 |
T |
 |
| Q |
106 |
tatatgatgagattagacggcacgaggagattctaggaaaattaaagaggggtctacatgttttccattcgcagaaccatttgtca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33818603 |
tatatgatgagattagacggcacgaggagattctaggaaaattaaagaggggtctacatgttttccattcgcagaaccatttgtca |
33818518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University