View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14051_high_16 (Length: 227)
Name: NF14051_high_16
Description: NF14051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14051_high_16 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0202 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0016 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 7 - 106
Target Start/End: Complemental strand, 29816 - 29717
Alignment:
| Q |
7 |
aagtttactcataaaatagtattcatctatgttacaattcagattaactggttggacccaattactttgtattgtccacttgatatattgataattggta |
106 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
29816 |
aagtttacttataaaatagtattcatctatgcaacaatttagattaactggttggacccaattactttgtgttgtccacttgatatatttatatttggta |
29717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 31094474 - 31094394
Alignment:
| Q |
8 |
agtttactcataaaatagtattcatctatgttacaattcagattaactggttggacccaattactttgtattgtccacttg |
88 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||| || || ||||||||||||||||||| | ||||||||| |
|
|
| T |
31094474 |
agtttacttataaaatagtattcgtctatgttacaattcattgtagctacttggacccaattactttgtgtcgtccacttg |
31094394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 227
Target Start/End: Complemental strand, 31094305 - 31094261
Alignment:
| Q |
182 |
caagaatcaatacaccatacaatagtaagaatctacaaatcttttt |
227 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||||||||||||||| |
|
|
| T |
31094305 |
caagaatcaatacaccatgcaataataa-aatctacaaatcttttt |
31094261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0202 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0202
Description:
Target: scaffold0202; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 71 - 212
Target Start/End: Complemental strand, 3107 - 2972
Alignment:
| Q |
71 |
ctttgtattgtccacttgatatattgataattggtatggtatagtgttgttgcaaaataatgattttaatttaattcaattaaattaatcaattctggga |
170 |
Q |
| |
|
||||||||||||| |||| |||||||||| || || || | ||||||||||||| |||||||| | |||||| ||||||||||||||||| ||||| |
|
|
| T |
3107 |
ctttgtattgtcctcttggtatattgatattt----tgctacactgttgttgcaaaaaaatgatttaa--ttaatttaattaaattaatcaattttggga |
3014 |
T |
 |
| Q |
171 |
aatcactatatcaagaatcaatacaccatacaatagtaagaa |
212 |
Q |
| |
|
||| ||| ||| ||||||||| | |||||||| |||||| |
|
|
| T |
3013 |
cttcaatatcccaataatcaatacgcaatacaataataagaa |
2972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University