View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14051_high_7 (Length: 382)
Name: NF14051_high_7
Description: NF14051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14051_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 366
Target Start/End: Complemental strand, 48276950 - 48276591
Alignment:
| Q |
1 |
tgtaaggagttggttcctttgagtttgagaattagcataaacataagaacaatcttctgttcttgttctacttccgaacgtggaagacgactccgattcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
48276950 |
tgtaaggagttggttcctttgagtttgagaattagcataaacataagaacaatcttctgttcttgttctacttcccaacgtggaagac---tccgattcc |
48276854 |
T |
 |
| Q |
101 |
tcggactcatcatgtgtccccgcacgttgcttttctgcttggtttttcagaactctagagtgtgacatcaacccagattggtgttggtgatattgatgat |
200 |
Q |
| |
|
|| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48276853 |
tctgactcat---gtgtccccgcacgttgcttttctgcttggtttttcaccactctagagtatgacatcaacccagattgctgttggtgatattgatgat |
48276757 |
T |
 |
| Q |
201 |
gaattgaactactatcatgatccaaacctaacaactgatgagggagtgcagtcaacgagccgccgttacctctcagcacttgttcaacaccaagttgaca |
300 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48276756 |
gaattgaactactatcatgatccacacctaacaactgatcagggagtgccgtcaacgcgccgccgttacctctcagcacttgttcaacaccaagttgaca |
48276657 |
T |
 |
| Q |
301 |
gaattgccactttccagtccataacagcccaactgctccatttactggatttatagttctcccaac |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48276656 |
gaattgccactttccagtccataacagcccaactgctccatttactggatttatagttctcccaac |
48276591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University