View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14052_high_9 (Length: 232)
Name: NF14052_high_9
Description: NF14052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14052_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 14584044 - 14583824
Alignment:
| Q |
1 |
gcatgtatattccttggtttccacataaggttgtctttgagttatagtttgtgcagatgattaattagagtgacaagtttatatgtattttatgtattca |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14584044 |
gcatgtatattccttggtttccacaaaaggttgtctttgagttatagtttgtgcagatgattaattagagtgacaagtttatatgtattttatgtattca |
14583945 |
T |
 |
| Q |
101 |
cctagttgcagacacaattgtcatgataatattaattaccatgatagctgtagaatttattgatcaaaggcttgatttgattctttgcattagattagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14583944 |
cctagttgcagacacaattgtcatgataatattaattaccatgatagctgtagaatttattgatcaaaggcttgatttgattctttgcattagattagtt |
14583845 |
T |
 |
| Q |
201 |
gcaaaaactcaatgatcaacc |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
14583844 |
acaaaaactcaatgatcaacc |
14583824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University