View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14052_low_10 (Length: 225)

Name: NF14052_low_10
Description: NF14052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14052_low_10
NF14052_low_10
[»] chr2 (1 HSPs)
chr2 (20-178)||(39428582-39428743)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 178
Target Start/End: Complemental strand, 39428743 - 39428582
Alignment:
20 ttttaagcgtttgaagtgtgttttatgtgaaccccacacaatcattgctcttcactttcattgcgattttgtctcaaaccacactcaacttatctcttct 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
39428743 ttttaagcgtttgaagtgtgttttatgtgaaccccacacaatcattgctcttcactttcattgcgattttgtctcaaaccacactcaactgatctcttct 39428644  T
120 ttcgcttttcaccatcttcatttattgcaactgtaagaaa---caactcaaccatatttctc 178  Q
    ||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||    
39428643 ttcgcttttcaccatcttcatttattgcaactgtaagaaacaacaactcaaccatatttctc 39428582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University